Predicting PIWI cleavage specificity via position-aware RNA interaction modeling
{{ preContent }}
The PAIRNet Cleavage Predictor is a deep-learning tool designed to predict the cleavage efficiency of piRNA (guide) and target RNA pairs.
Unlike traditional thermodynamics-based predictors, this tool uses an ensemble of 10 neural networks trained on high-throughput experimental cleavage data. It provides a Relative Cleavage Score, comparing your specific target variant against a theoretical "Perfect Match."
To ensure accurate predictions, please strictly follow these formatting rules. The model is sensitive to sequence length and directionality.
This string describes the specific mismatch or pairing architecture. It must follow the strict format:
g[Start]:g[End]:[Count]mm:[Position]:[Mutation]
Breakdown of the format:
g2:g26: Indicates the region of the guide involved
in pairing (usually bases 2 through 26).
Xmm: The number of mismatches (e.g., 1mm for one
mismatch, 0mm for perfect match).
Position: The position of the mutation relative to
the 5' end of the guide (e.g., 10).
Mutation: The specific base change (e.g., AU means
an A in the wild type was mutated to U).
Example: g2:g26:1mm:10:AU
Interpretation: Pairing occurs from g2 to g26; there is 1 mismatch located at position 10; the mutation represents an A U change.
If you are new to the tool, try these inputs to see how the prediction works.
Scenario: A Single Point Mutation at Position 10
TGAGGTAGTAGGTTGTATAGTATCCATGGATACTATACAACCGACTACCTCAg2:g26:1mm:10:AGStep-by-Step:
Other examples to try:
TGAGGTAGT A GGTTGTATAGTATCCA 5->3 TGGATACTATACAACC G ACTACCTCA 5->3 g2:g26:1mm:10:AG ================================== ENSEMBLE RESULTS (Median of 10 models) RELATIVE K RATIO: 0.1641 ==================================================
TG A GGTAGTAGGTTGTATAGTATCCA 5->3 TGGATACTATACAACCTACTACC A CA 5->3 g2:g26:1mm:3:AA ================================== ENSEMBLE RESULTS (Median of 10 models) RELATIVE K RATIO: 0.5697
TGAGGTAGTAGGTTGTATAG T ATCCA 5->3 TGGAT G CTATACAACCTACTACCTCA 5->3 g2:g26:1mm:21:UG ================================== ENSEMBLE RESULTS (Median of 10 models) RELATIVE K RATIO: 0.9675
The tool outputs two main values: the Relative Cleavage Rate and the Confidence Interval.
Because absolute cleavage rates ($k_{obs}$) can vary between experiments, we report a Ratio relative to a perfect match.
We use an Ensemble of 10 Models to make every prediction.